For over a year, our trusted “health experts and fact checkers” have been telling us that mRNA vaccines, including Pfizer and Moderna, do not not integrate themselves into human cellular DNA. However, a bombshell new study published in Current Issues of Molecular Biology shows that the health experts and fact checkers were wrong.
Lab studies show that mRNA vaccines DO integrate themselves into human cellular DNA. In essence, the vaccines change your DNA forever.
BYPASS THE CENSORS
Sign up to get unfiltered news delivered straight to your inbox.
You can unsubscribe any time. By subscribing you agree to our Terms of Use
What it is saying is: lab studies show that mRNA vaccine DOES integrate itself into human cellular DNA. This means that a shot of Pfizer vaccine, taken even once, permanently changes the DNA of affected cells.
Mainstream media and fact checkers have dedicated themselves to telling us the opposite:
However, the bombshell article from Current Issues of Molecular Biology suggests they have been spreading disinformation all along.
A new study is out: Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line.
IgorChudov reports:
What it is saying is: lab studies show that mRNA vaccine DOES integrate itself into human cellular DNA. This means that a shot of Pfizer vaccine, taken even once, permanently changes the DNA of affected cells.
However, the bombshell article from Current Issues of Molecular Biology shows the opposite.
What the article shows is that in vitro, using a human liver cell line, Pfizer mRNA vaccine uses a natural reverse transcriptase enzyme called LINE-1, and the genetic code of the vaccine is reverse transcribed into the DNA.
It also explains that vaccine mRNA actually does travel to the liver as one of the preferred sites (the other sites, as we heard, are ovaries and more).
What does it mean? Normally, our cells do the opposite: the cell nucleus, where the DNA is, expresses certain DNA code based on conditions of the cell, and produces natural, human messenger RNA. That messenger RNA travels out of the nucleus, where it is expressed into proteins needed for cell building. This is how growing organisms express different genetic programs to grow muscle cells or brain cells, etc.
This process is called “transcription”.
For many years, Central Dogma of Molecular Biology stated that the “reverse transcription” — moving genetic code from RNA back into the sacred cellular nucleus and recoding the DNA — was impossible. Eventually, scientists realized that it is possible under various conditions. For example, the HIV RNA virus is able to do so and it reprograms our DNA to produce copies of it. HIV is the virus that causes AIDS.
To effect reverse transcription, enzymes called “reverse transcriptases” are needed. One of them is called LINE-1.
Apparently, per study, the Pfizer mRNA vaccine causes cells to produce that LINE-1 enzyme.
After seeing LINE-1 reverse transcriptase rise, they tested for alterations to the DNA, making sure they are not picking up the RNA instead.
The genetic code that they picked up is:
CGAGGTGGCCAAGAATCTGAACGAGAGCCTGATCGACCTGCAAGAACTGGGGAAGT ACGAGCAGTACATCAAGTGGCCCTGGTACATCTGGCTGGGCTTTATCGCCGGACTGATTG CCATCGTGATGGTCACAATCATGCTGTGTTGCATGACCAGCTGCTGTAGCTGCCTGAAGG GCTGTTGTAGCTGTGGCAGCTGCTGCAAGTTCGACGAGGACGATTCTGAGCCCGTGCTGAAGGGCGTGAAACTGCACTACACATGATGACTCGAGCTGGTACTGCATGCACGCAATGCTA GCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGC TCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGC AGCAATGCAGCTCAAAACGCTTAGCCTAAnyone wants to run BLAST on it?
Simplified
As I explained in response to a questioner:
Pfizer mRNA vaccine changes our genetic code that determines how our organisms operate, that you inherited from your mom and dad. Now your DNA was changed from what your mom and dad gave you, by adding a little mysterious “edit” from Pfizer.
Your organism acts in accordance with your DNA program, and now, well, the program has been hacked and modified by Pfizer.
Cancer Code
Considering that Sars-Cov-2 “spike protein” has cancer code from Moderna 2017’ patent 9,587,003, it is imperative to find out the implications of this reverse transcription, and whether the vaccinated now have any undesirable genetic code embedded into their DNA.
Of particular interest is whether this mRNA-induced reverse transcription affects the “germ line”, such as eggs and sperm cells, and whether it also affects the fetus of pregnant mothers.
Please repost this article far and wide due to its big implication for our public health.
EDIT: Our astute commenter pointed out an anonymous 4chan post from Dec 2020, long before any of this became known. The date makes us all ask, did this person know too much?
Baxter Dmitry
Email: baxter@thepeoplesvoice.tv
Latest posts by Baxter Dmitry (see all)
- Cambridge Scientists Admit 25% of Vaccinated People Now Have VAIDS - December 9, 2023
- Study Reveals mRNA Vaccines Are ‘Reactivating’ Previously Dormant Viruses and Diseases - December 9, 2023
- WEF Orders Govt’s To Arrest Whistleblowers Who Expose Depopulation Agenda - December 9, 2023
ONE BIG effing DUHHHHHH!!!!
After the panic sets in, then what? Will vaccinated seek vengeance?
Only fools rush in.
They won’t even read it cause the msm won’t ever tell them They ll never know Its exactly like they gave innocent kiddies in the 1960s the sugar cube with the polio vaccine that is guaranteed to give them cancer. Most people still don’t know. And cancer is the real pandemic that has killed millions and millions. And they act as if its just normal.
Humans of earth have 2 choices, to evolve, or to allow the devolved entities ruling this world to make you devolve as they have done.
States are storing food, stockpiling what you can’t buy in the future. They will starve you all into submission.
The food will be used to lure people into the FEMA camps, offered to them if theytake the vaccines and the digital ID.
Once they take the bait, the food will be withdrawn, a “bait and switch”.
However the real issue is that we have human rights, once you take the vaccines and the digital ID tyou will no longer be “human” and therefore have no “human” rights.
The world war is also in place to force nations to surrender, force mandatory injections that will take away your souls and make you non-humans, devolved.
War will also end your nation and its laws and all Human Rights laws and practices.
The irony is that these beings at the top calling themselves the “elite” are not human. They are formerly human bodies that are possessed by demons from Hell.
All freemasonry, is satanic.
At the top, 33 freemasonry and above, all are possessed by the fallen angels.
The fallen angels are demonic entities from Hell.
They are even more devolved than demons, and less evolved than humans.
They have never even ever, been human.
They now rule the world as the ‘ORDER’, the NWO, OWO to be coming from ww3.
They are antichrist, soulless, Godless enemies of God.
They want to make you destroy your souls and lose all connection to God.
They work together for one goal:to make all humans with souls end up in Hell for all eternity with them.
They will destroy all life on earth in a very short time.
Earth will become dead and non-life sustaining very soon because of their activities.
When they cry climate change the truth is they are really working at killing the earth itself, making it a dead lifeless planet.
Because they want to return to Hell and they prefer Hell, they love everything about Hell. They believe they are superior to God and hell is superior to Heaven.
They are totally INSANE.
Whatever they need to do, to kill everyone, they will do.
This is the end of all life on earth becasue of their secret machinations.
Whatever they tell you, the exact oppoite is the truth.
The choice you have is only this one:
To die with a soul and get to heaven, or die without a soul and burn in Hell forever.
The entire earth and the sun will be gone soon and only the spirit world we go to after death will continue.
The sheep and the goats are being separated and a new better world will be created for the sheep.
People are dumb but corript immoral guilty of every sin in the Bible really Ordinary normal people. And they don’t even know it and rhe Churches don’t even tell them So they won’t even think they need to repent so are destined fir Hell
And rhe Church crowds are the MOST deceived of all and they’re full of hypocrites who will actually be rhe worst sinners in Hell
The most vile of sinners hide in churches. John 14:9 takes care of them, but it IS up to us to ACTIVELY ferret them out for the safety of the community, especially for the children who fall to being kidnapped in high numbers by these maggots. Satanism is real, but evil is a lesser deity. “ALWAYS maintain the higher moral ground”. Sun Tzu
the vaccinated are busy boning up on knowledge of Ukraine. so, they just can’t be bothered with this knowledge right now. before that, they couldn’t even name the fifty states, much less their capitals. bush’s common core and obama flapping his lips has devolved this group of american citizens into parrots. meanwhile, the social security administration has taken your dead brother’s social security number, reinstated his benefits and deposits them directly onto a debit card for a recent ukrainian arrival to garner the voting rights and social security benefits of your dead brother. he then uses those benefits to participate in antifa riots in seattle, portland, detroit, chicago, new jack city. they live in our little town. right now they lay low only showing up Fridays for “sign flying day” in front of the grocery store. that’s their weed money. and your mayor approves. just in case he needs them for a maidan revival during municipal elections. what he doesn’t realize is those guys aren’t meant for him. they are meant for the thirty year old Soros fellow nothing who is running against you using a “hope and change” paradigm. me, i give them a box of cookies. on Christmas only. i tell them its victory nuland day and they get all glazed over? who needs a joint when you can get stupid just from being offered a single thought provoking comment. these are just silly suppositions.
I wrote about all of this in August 2020 and released an article. It was mocked and banned on Linked In. The science was out there in publications well before now.
Strange how the people spreading “misinformation” are always correct
So their fraudulently described and prescribed “vaccine” that neither prevents infection infection, nor transmission, is in fact a retrovirus.
Effectively. And from the minute so called CORONA virus emerged from the labs FROM FORT DETRICK,, I said they’ve made this from the aids virus.
Everyone who has had even just 1 jab is now undergoing TRANSHUMISM and will be, irreversibly, for the term of their now UN NATURAL life.
“never trust anyone” HRH Queen Mum.
And this is exactly why they’re obedience trained everyone through workplace education and training into total compliance. So they could jab them. And they’re so brainwashed, and have no idea, that even with this information they will still just obey and comply Exactly like UNDETECTABLE mind controlled robots.
The Pandemic story spread from Ferguson “projections” from the Imperial College, over to Fauci who instructed Trump. Concurrently Dr WHO from the UN , created by the The Lucifer Trust originally then renamed The Lucis Trust, ran the operation Globally through every minion in health ministries globally undervlawscprevemptivelynestablished by the Rule of law empowering health ministers to take the power from democratically elected leaders into their own hands as obedient servants of the team leader Director General Tedros. Its connected with Fort Detricks research into germ warfare, but I’m confident it’s directly resulted from Faucis billions in research grants to discover the secrets of the retrovirus known as AIDS.
Graphene is bad mkay
Return of the Nephilim
you got that right. Nothing new under the sun.
So in the days of Noah, that is how you will know.
Once a person’s DNA is altered to something non-human, then Jesus’ sacrifice becomes null and void for that person because God manifest Himself as a human to die for the sins of humans. This is why the Mark of the Beast guarantees damnation for anyone who receives it. The Mark of the Beast changes a person’s DNA to something other than human. Therefore, Jesus didn’t pay for that non-human’s sins.
powerful thought that I don’t disagree with, but I think a good portion of the vaccines were saline solutions mixed in with the poisons. they were going to play catch up with the boosters. but i think the boosters are not sitting well with the public. They are going to resort to another type of outbreak. I am thinking a new variant of small pox. they will be able to alter more DNA.
When i first heard that the vaccines were RNA messengers, I decided the very next half second that there was no way I would take that thing. I am amazed how so many people just clawed and elbowed their way to the front of the line, and then bragged about it for months later. really big loud forehead slap. I am appauled. can’t spell it correctly but I am.
I think we’re witnessing the largest human sacrifice to Satan in history, ever.
Book of Enoch spells it out very well. this book pulled it all together for me. To me, this book is one of the most important books.
I haven’t read it. I’ve heard people talk about things it says quite a bit, though.
Excellent reference to read with the Bible. Well worth it.
I looked to see about getting a copy, but there are several different offerings online. I didn’t know this, but apparently there are “books” of Enoch, and of “Giants” and a few other books all in a bundle. Which should I get? Is there a specific one? Or are all of them the way to go? I’m not interested in anything that contradicts the Scriptures of the Bible and I don’t want to waste my time or money on things that do that.
An excellent question and well worth asking. When I discovered about the existence of the Book of Enoch, I didn’t realise that I would have to battle through deceptions on that level too. There are 3 Books named Enoch or associated with the name Enoch. Only the first book is by the good Enoch. I didn’t even know that there were 2 Enochs in the Bible, but there you go. If I recall correctly, the 3rd book attributed to Enoch, was written by a Rabbi, and neither the second and third books are recommended reading for Bible scholars, unless of course you are researching something. The book of Enoch opens with a fascinating verse –
CHAP. 1.—The words of the blessing of Enoch where-with he blessed the chosen and just, who will exist on the day of tribulation when all the wicked and impious shall be removed.
So I think this book is truly for this time. Let me know if you need any info, but I’m sure you will figure it out. Have a blessed day.
I’m sorry Pfizer, but you should have given this information BEFORE scamming your profits from the sales of EVERYTHING COVID!!!
The class actions begin, and your idiotic scamming lawyers won’t get you out of this jam..!!
Not even the fake war can stop us!!!!
You all know that newspunch is just baiting us all. Its founders are two sick sodomists destined for hell forever.
Any fair trial would have these pigs hung by noon.
If it permanently alters DNA then why the need for boosters? I know why. the “vaccines” are not to prevent C19, but to weaken your immune system for the next wave that is coming. The next virus will kill the vaccinated, while the stubborn anti vaxxers will continue to live with the wretched natural immune systems!!! Dam them, dam them all!!!
Just as everything we ever do or did mods our DNA
Nkgoo, geniş kapsamlı bilgi platformudur. Her konuda bilgi içeriği üretme amacıyla yayın hayatına başlamış referans kaynak sitedir. Ayrıca telif hakları konularına da özen gösterilmektedir.
It does indeed permanently alter ones DNA .
These people deserve to be executed . The only reason they’re injecting young children with the Covid vaccine is to permanently sterilize them . Many aren’t aware that’s what was one of the main WEF objectives and why these companies wanted the information to be hidden for 75 years .